Skip to content

The Digital Health Update — Paul Sonnier

March 26, 2013

I sent the following announcement to 16,305 Digital Health group members on March 26, 2013:

The Digital Health Update — Paul Sonnier

Dear Digital Health group members,

In this update:

(1) Digital Health on TV — Dr. Leslie Saxon
(2) FDA Mobile Medical Apps Guidance — Bradley Merrill Thompson
(3) FDA Guide for Digital Health Entrepreneurs — Rock Health
(4) Petition to Congress on HHS Establishing Standards for a Unique Patient Identifier — Brian Ahier
(5) Discussion on Blood Monitoring Implant and Claims of Heart Attack Prediction
(6) Text-to-DNA Translator — Synthetic Genomics

 

(1) DIGITAL HEALTH ON TV — DR. LESLIE SAXON

Dr. Leslie Saxon’s work with digital health was featured in a recent episode of CNN’s “The Next List”. Dr. Saxon is the Executive Director of the USC Center for Body Computing, where she organizes the annual Body Computing Conference, which is always fantastic.
VIDEO

Notable Digital Health group members who are also featured in the video include Dr. David Albert (AliveCor / iPhone ECG), Brian Russell (Zephyr Technology), and Sonny Vu (Misfit Wearables).
Related group discussion

 
(2) FDA MOBILE MEDICAL APPS GUIDANCE — BRADLEY MERRILL THOMPSON

Following Congressional hearings last week on “Health Information Technologies: Harnessing Wireless Innovation”, group member Bradley Merrill Thompson shared his thoughts on the FDA’s pending publication of its final guidance on mobile medical apps. Of particular note are Brad’s comments on the gray area between “unregulated wellness and regulated disease claims”, FDA’s clearance pathway, quality system requirements, accessory rule, and enforcement for mobile medical apps, plus the potential for guidance on pharmaceutical apps.
Group discussion and link to Brad’s post.

VIDEO of the first day of the Congressional hearings features Brad and other Digital Health group members, including Robert Jarrin, Senior Director of Government Affairs at Qualcomm, Ben Chodor, CEO at Happtique, and Jonathan Spalter, Chairman of Mobile Future is available here.

 
(3) FDA GUIDE FOR DIGITAL HEALTH ENTREPRENEURS — ROCK HEALTH

With the FDA on the verge of finalizing their mobile medical apps guidance, Rock Health published this helpful guide for digital health entrepreneurs.

 
(4) PETITION TO CONGRESS ON HHS ESTABLISHING STANDARDS FOR A UNIQUE PATIENT IDENTIFIER — BRIAN AHIER

Brian Ahier, a well known Health IT evangelist and, of course, Digital Health group member, created a White House petition asking Congress to no longer prohibit HHS from establishing standards for a unique patient identifier. Brian added additional background in the group regarding the Healthcare Information and Management Systems Society’s (HIMSS) recommendations to Congress on the need for a patient identity. Additional info and comments by group members.

 
(5) DISCUSSION ON BLOOD MONITORING IMPLANT AND CLAIMS OF HEART ATTACK PREDICTION

Several group members pointed out issues with claims of heart attack prediction related to troponin. Note that this device is not on the market or cleared by FDA.

 
(6) TEXT-TO-DNA TRANSLATOR — SYNTHETIC GENOMICS

Following my tweet of this nifty translator, I was delighted to get a mention by new group member Linda Avey, Co-founder of 23andMe: @lindaavey: GTCTAAATATAGCTATAAATATTTTCCCTACTGCGTTCCGCT! sgidna.com/translator.php h/t @paul_sonnier
Group discussion and link to converter (decode what Linda tweeted!).

 
Best regards,
Paul Sonnier

Head of Digital Health Strategy, Popper and Company
Founder, 16,000+ member Digital Health group on LinkedIn
Mentor, Blueprint Health
Twitter: @Paul_Sonnier

Advertisements

From → Uncategorized

One Comment
  1. John Hoben permalink

    Paul – thanks for including me in LinkedIn’s Digital Health Group. I look forward to seeing you when I’m in La Jolla later this spring.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

%d bloggers like this: